naei restriction enzymes (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
94
Structured Review
New England Biolabs
naei restriction enzymes
Naei Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/naei+restriction+enzymes/NaeI/pmc12752508-171-13-16
Average 94 stars, based on 130 article reviews
Naei Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/naei+restriction+enzymes/NaeI/pmc12752508-171-13-16
Average 94 stars, based on 130 article reviews
naei restriction enzymes - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Construct:Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and Plasmid Preparation:Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate. Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences (Lmx1>Lmx1::VP64) was obtained by first cloning Lmx1 regulatory sequences (Lemaire et al., 2021) into an expression vector containing the VP64 activation domain (Gainous et al., 2015) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences ( Lmx1 > Lmx1::VP64 ) was obtained by first cloning Lmx1 regulatory sequences ( ) into an expression vector containing the VP64 activation domain ( ) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Sequencing:Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate. Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences (Lmx1>Lmx1::VP64) was obtained by first cloning Lmx1 regulatory sequences (Lemaire et al., 2021) into an expression vector containing the VP64 activation domain (Gainous et al., 2015) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences ( Lmx1 > Lmx1::VP64 ) was obtained by first cloning Lmx1 regulatory sequences ( ) into an expression vector containing the VP64 activation domain ( ) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Amplification:Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate. Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences (Lmx1>Lmx1::VP64) was obtained by first cloning Lmx1 regulatory sequences (Lemaire et al., 2021) into an expression vector containing the VP64 activation domain (Gainous et al., 2015) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences ( Lmx1 > Lmx1::VP64 ) was obtained by first cloning Lmx1 regulatory sequences ( ) into an expression vector containing the VP64 activation domain ( ) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Clone Assay:Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and Polymerase Chain Reaction:Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate. Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences (Lmx1>Lmx1::VP64) was obtained by first cloning Lmx1 regulatory sequences (Lemaire et al., 2021) into an expression vector containing the VP64 activation domain (Gainous et al., 2015) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and Article Title: Pair-rule-like transcription patterns during neural tube closure in a proto-vertebrate Article Snippet: The transgene expressing the constitutively active Lmx1 transcription factor controlled by Lmx1 regulatory sequences ( Lmx1 > Lmx1::VP64 ) was obtained by first cloning Lmx1 regulatory sequences ( ) into an expression vector containing the VP64 activation domain ( ) using the NotI and AscI restriction enzymes (New England Biolabs). .. The coding sequence of Lmx1 was then PCR amplified, digested with NotI and |